John TAGG, et al. : Streptococcus salivarius K12 vs Halitosis
-- Articles & patents

**[![](0logo.gif)](../index.htm)  
[rexresearch.com](../index.htm)**

---

**John TAGG*****, et
al.***  
**Streptococcus salivarius K12 vs Halitosis**



---



---

  
**1. [Lydia Ramsey : We've been fighting morning
breath all wrong](#1)****2. [J. Tagg, et al. : A preliminary study of
the effect of probiotic Streptococcus salivarius K12 on oral
malodour parameters.](#2)****3. [J. Tagg, et al. : The rationale and
potential for the reduction of oral malodour using
Streptococcus salivarius probiotics.](#3)****4. [J. Tagg, et al. : A preliminary study of
the effect of probiotic Streptococcus salivarius K12 on oral
malodour parameters.](#4)****5. [Masdea L, et al. : Antimicrobial activity
of Streptococcus salivarius K12 on bacteria involved in oral
malodour.](#5)****6. [J. Tagg, et al. : Developing Oral
Probiotics From Streptococcus salivarius](#6)****7. [BLIS K12, A futuristic supplement that is
here and now](#7)****8. [Patents](#patents)**  
  



---

[**http://www.businessinsider.com/can-you-use-a-probiotic-to-fix-bad-breath-2015-11**](http://www.businessinsider.com/can-you-use-a-probiotic-to-fix-bad-breath-2015-11)**14 November 2015**

**We've been fighting morning breath all
wrong**  
  
*Listerine doesn't work.*  
**by**  
  
**Lydia Ramsey**

  
In the near future, the cause of our stinky morning breath could
be the thing that helps us beat it. Our body is filled with
trillions microorganisms. Some of those microbes hang out in our
mouth, which is nice and humid. While we sleep, our mouths
sometimes dry out, which can kill off some good bacteria and cause
gas-emitting bacteria to thrive. That's the reason you sometimes
wake up with a putrid-smelling mouth.  
  
But, there's a solution, and its name is Streptococcus salivarius
K12. Researchers think the bacteria strain could soon be put into
a lozenge or spray and used as a probiotic, or beneficial mix of
bacteria, to knock out the bad bacteria that causes bad breath.   
  
The delicate balance of microbes living inside each one of us,
collectively called our microbiome, helps keep our body running.
Unfortunately, things we do - like taking antibiotics, for example
- can wipe out many of these beneficial microbes, throwing off the
balance.  
  
Susan Perkins, one of the curators of a recent exhibit at the
American Museum of Natural History focused on the microbiome, told
Business Insider she wouldn't be surprised if we started using
bacteria to treat morning breath within the year.  
  
A 2006 study of 23 people with halitosis, or bad breath, found
that those given S. salivarius K12 lozenges had lower levels of
smelly breath. The participants started by using an antimicrobial
mouthwash followed by either a placebo lozenge or one with S.
salivarius K12. They found that the addition of the bacteria
reduced the levels of smelly breath better than the mouthwash on
its own.   
  
Ideally, this probiotic could be used in addition to mouthwashes
like Listerine, which kill all the bacteria - good and bad - in
your mouth. Andrea Azcarate-Peril, the director of the University
of North Carolina's Microbiome Research Core, told Business
Insider that antibacterial solutions like mouthwash and hand
sanitiser are being overused to the point where they could be
doing more harm than good.  
  
"We are just too clean," she said.  
  
But probiotics aren't a perfect solution either. At least not yet.
We still don't know everything about the bacteria in our bodies,
and not every probiotic works for every person. Plus, probiotics
still aren't regulated by the FDA, so it's a little tricky to know
if the supplements people are taking are actually doing what they
say they are.   
  
Even so, the probiotics industry is expanding. The hope is to
eventually use these probiotics to treat everything from cancer to
bad body odour, said Perkins.  
  
In the meantime, keep your eye out for S. salivarius K12.   
  


---

  
[**http://www.ncbi.nlm.nih.gov/pubmed/16553730**](http://www.ncbi.nlm.nih.gov/pubmed/16553730)**J Appl Microbiol. 2006 Apr;100(4):754-64.**

**A preliminary study of the effect of
probiotic Streptococcus salivarius K12 on oral malodour
parameters.**

**Burton JP, Chilcott CN, Moore CJ, Speiser G, Tagg JR.****Abstract**  
**AIMS:**  
  
To determine whether dosing with bacteriocin-producing
Streptococcus salivarius following an antimicrobial mouthwash
effects a change in oral malodour parameters and in the
composition of the oral microbiota of subjects with halitosis.  
  
**MATERIALS AND RESULTS:**  
  
Twenty-three subjects with halitosis undertook a 3-day regimen of
chlorhexidine (CHX) mouth rinsing, followed at intervals by the
use of lozenges containing either S. salivarius K12 or placebo.
Assessment of the subjects' volatile sulphur compound (VSC) levels
1 week after treatment initiation showed that 85% of the
K12-treated group and 30% of the placebo group had substantial
(>100 ppb) reductions. The bacterial composition of the saliva
was monitored by culture and PCR-denaturing gradient gel
electrophoresis (PCR-DGGE). Changes in the PCR-DGGE profiles
occurred in most subjects following K12 treatment. In vitro
testing showed that S. salivarius K12 suppressed the growth of
black-pigmented bacteria in saliva samples and also in various
reference strains of bacteria implicated in halitosis.  
  
**CONCLUSIONS:**  
  
Administration of bacteriocin-producing S. salivarius after an
oral antimicrobial mouthwash reduces oral VSC levels.  
  
**SIGNIFICANCE AND IMPACT OF THE STUDY:**  
  
The outcome of this preliminary study indicates that the
replacement of bacteria implicated in halitosis by colonization
with competitive bacteria such as S. salivarius K12 may provide an
effective strategy to reduce the severity of halitosis.  
  


---

  
[**http://www.ncbi.nlm.nih.gov/pubmed/15752094**](http://www.ncbi.nlm.nih.gov/pubmed/15752094)**Oral Dis. 2005;11 Suppl 1:29-31.**

**The rationale and potential for the
reduction of oral malodour using Streptococcus salivarius
probiotics.**  
  
**Burton JP, Chilcott CN, Tagg JR.**

**Abstract**  
The primary treatment for oral malodour is the reduction of
bacterial populations, especially those present on the tongue, by
use of a variety of antimicrobial agents or mechanical devices.
However, shortly after treatment the problematic bacteria quickly
repopulate the tongue and the malodour returns. In our studies, we
have used a broadly-active antimicrobial (chlorhexidine) to effect
temporary depletion of the oral microbiota and then have attempted
to repopulate the tongue surface with Streptococcus salivarius
K12, a benign commensal probiotic. The objective of this is to
prevent re-establishment of non-desirable bacterial populations
and thus help limit the re-occurrence of oral malodour over a
prolonged period. In this paper, we discuss why contemporary
probiotics are inadequate for treatment of oral malodour and
examine the rationale for selection of particular bacterial
species for future use in the treatment of this condition. In our
preliminary trials of the use of a chlorhexidine rinse followed by
strain K12 lozenges, the majority (8/13) of subjects with
confirmed halitosis maintained reduced breath levels of volatile
sulphur compounds for at least 2 weeks. We conclude that probiotic
bacterial strains originally sourced from the indigenous oral
microbiotas of healthy humans may have potential application as
adjuncts for the prevention and treatment of halitosis.  
  


---

  
[**http://www.ncbi.nlm.nih.gov/pubmed/16553730**](http://www.ncbi.nlm.nih.gov/pubmed/16553730)**J Appl Microbiol. 2006 Apr;100(4):754-64.**

**A preliminary study of the effect of
probiotic Streptococcus salivarius K12 on oral malodour
parameters.**  
  
**Burton JP, Chilcott CN, Moore CJ, Speiser G, Tagg JR.**

**Abstract****AIMS:**  
  
To determine whether dosing with bacteriocin-producing
Streptococcus salivarius following an antimicrobial mouthwash
effects a change in oral malodour parameters and in the
composition of the oral microbiota of subjects with halitosis.  
  
**MATERIALS AND RESULTS:**  
  
Twenty-three subjects with halitosis undertook a 3-day regimen of
chlorhexidine (CHX) mouth rinsing, followed at intervals by the
use of lozenges containing either S. salivarius K12 or placebo.
Assessment of the subjects' volatile sulphur compound (VSC) levels
1 week after treatment initiation showed that 85% of the
K12-treated group and 30% of the placebo group had substantial
(>100 ppb) reductions. The bacterial composition of the saliva
was monitored by culture and PCR-denaturing gradient gel
electrophoresis (PCR-DGGE). Changes in the PCR-DGGE profiles
occurred in most subjects following K12 treatment. In vitro
testing showed that S. salivarius K12 suppressed the growth of
black-pigmented bacteria in saliva samples and also in various
reference strains of bacteria implicated in halitosis.  
  
**CONCLUSIONS:**  
Administration of bacteriocin-producing S. salivarius after an
oral antimicrobial mouthwash reduces oral VSC levels.  
  
**SIGNIFICANCE AND IMPACT OF THE STUDY:**  
The outcome of this preliminary study indicates that the
replacement of bacteria implicated in halitosis by colonization
with competitive bacteria such as S. salivarius K12 may provide an
effective strategy to reduce the severity of halitosis.  
  


---

**Arch Oral Biol. 2012 Aug;57(8):1041-7.   
doi: 10.1016/j.archoralbio.2012.02.011.   
Epub 2012 Mar 10.**

**Antimicrobial activity of Streptococcus
salivarius K12 on bacteria involved in oral malodour.**  
  
**Masdea L, Kulik EM, Hauser-Gerspach I, Ramseier AM, Filippi
A, Waltimo T.**

**Abstract****OBJECTIVE:**  
  
To investigate the antimicrobial activity of the
bacteriocin-producing strain Streptococcus salivarius K12 against
several bacteria involved in halitosis.  
  
**DESIGN:**  
  
The inhibitory activity of S. salivarius K12 against Solobacterium
moorei CCUG39336, four clinical S. moorei isolates, Atopobium
parvulum ATCC33793 and Eubacterium sulci ATCC35585 was examined by
a deferred antagonism test. Eubacterium saburreum ATCC33271 and
Parvimonas micra ATCC33270, which have been tested in previous
studies, served as positive controls, and the Gram-negative strain
Bacteroides fragilis ZIB2800 served as a negative control.
Additionally, the occurrence of resistance in S. moorei CCUG39336
to S. salivarius K12 was analysed by either direct plating or by
passage of S. moorei CCUG39336 on chloroform-inactived S.
salivarius K12-containing agar plates.  
  
**RESULTS:**  
  
S. salivarius K12 suppressed the growth of all Gram-positive
bacteria tested, but the extent to which the bacteria were
inhibited varied. E. sulci ATCC35585 was the most sensitive
strain, while all five S. moorei isolates were inhibited to a
lesser extent. Natural resistance seems to be very low in S.
moorei CCUG39336, and there was only a slight decrease in
sensitivity after exposure to S. salivarius K12 over 10 passages.  
  
**CONCLUSION:**  
  
Our studies demonstrate that S. salivarius K12 has antimicrobial
activity against bacteria involved in halitosis. This strain might
be an interesting and valuable candidate for the development of an
antimicrobial therapy for halitosis.  
  


---

  
[**http://www.medscape.com/viewarticle/777316\_4**](http://www.medscape.com/viewarticle/777316_4)**Future Microbiol. 2012;7(12):1355-1371.** **[ Excerts ]**

**Developing Oral Probiotics From
Streptococcus salivarius**  
  
**Philip A Wescombe; John DF Hale; Nicholas CK Heng; John R
Tagg**

**Development of S. salivarius Probiotics: General Principles**  
The Food and Agricultural Organization and WHO have published a
list of recommended guidelines for the systematic assessment and
development of strains that are under consideration as
probiotics.[2] While this document focuses particularly on
intestinal probiotics, its recommendations can be considered
generally applicable to all probiotics. Some of the key steps
taken in the commercial development of a probiotic are shown in
Figure 1. It is important to note that, in practice, the process
does not always follow an orderly pathway (especially in the
developmental stage), and that some steps may prove especially
problematic and need to be repeated prior to obtaining a
successful and efficacious end-product.  
  
**Steps required for the development of a probiotic.****Candidate Screening & Selection...**  
  
**Safety Evaluation****...**  
**Stability & Shelf Life**...  
  
**Probiotic Production****...**  
  
**Profiles of Proposed S. salivarius Probiotics: Past, Present
& Potential****Early Entries**...  
  
**Current Contenders****S. salivarius K12**  
Although S. salivarius K12 was initially selected on the basis of
its broad inhibitory activity against S. pyogenes, it has
subsequently been demonstrated to provide more diverse health
benefits a ranging from the alleviation of halitosis to
stimulation of antiviral immune defenses and the reduction of
episodes of OM. This broad spectrum of potential health benefits
conferred throughout the life of the human host has prompted the
adoption of the colloquial moniker for this strain, "BLIS K12 a
the probiotic for all ages" (Figure 2).  
  

![](777316-fig4.jpg)   
  
*Streptococcus salivarius: the probiotic for all ages.
Diseases that may be alleviated by Streptococcus salivarius
probiotics and the ages at which they generally tend to
manifest.**Reproduced with permission from [77].*  
![](777316-fig3.jpg)  
  
*Figure 3. Electron microscope image demonstrating the
attachment of Streptococcus salivarius K12 to HEp-2 cells.* *Image courtesy of M Rohde.*

  
In 2001, strain K12 became the first S. salivarius to be
commercially developed as a probiotic and more than 50 million
doses have now been marketed internationally by the New Zealand
company BLIS Technologies Ltd (Dunedin, New Zealand). A
substantial body of research was undertaken to underpin the safe
and efficacious application of the strain to humans and this
included a variety of clinical interventions in both animals and
humans. Although S. salivarius is not commonly consumed as a
naturally occurring food ingredient, it is nevertheless considered
a low-risk organism since, in spite of its apparently invariable
and plentiful presence in the human oral cavity, it is only very
rarely a cause of infection in humans who are immunologically
competent.[27] The safety of strain K12 has been specifically
supported by a series of studies: affirming the absence of known
streptococcal virulence factors and antibiotic resistance
determinants; showing its low mutagenicity predisposition; acute
and subacute toxicity testing in rats; and a high-dosage trial in
humans.[29,35,36] The outcome of these strain-specific studies,
together with recognition of the inherent safety of the species,
has enabled a self-affirmed 'generally regarded as safe' (or
'GRAS') status to be granted for strain K12 in the USA.
Interestingly, the species S. salivarius is still generally
classified as a risk group 2 organism in Europe; however, on the
basis of its safety profile strain, K12 has been specifically
reclassified as a risk group 1 organism in Germany by the AusschuA
fA1/4r Biologische Arbeitsstoffe (Translation: Committee on
Biological Agents).[43]  
  
The original source of S. salivarius K12 was a healthy schoolchild
who had maintained a large indigenous oral cavity population of
the K12 strain for a period of more than 12 months, during which
time no new S. pyogenes infections were experienced. A distinctive
(and indeed patentable) feature of strain K12 was its production
of two novel lantibiotics (salivaricin A2 and B), both of which
were shown in vitro to have inhibitory activity against S.
pyogenes, the principal causative agent of streptococcal
pharyngitis.[44] Further support, albeit indirect, for the
protection offered by S. salivarius BLIS against S. pyogenes
infection came from studies showing that children who harbored
oral populations of salivaricin A- and/or B-producing S.
salivarius had significantly fewer new acquisitions of S. pyogenes
than did children who appeared not to have BLIS-producing S.
salivarius (17 vs 32%, respectively).[45] Another study showed
that children who frequently experienced clinically confirmed sore
throats were significantly less likely to have BLIS-producing S.
salivarius than children who had not experienced sore throats in
the past 3 years.[46] Furthermore, competition experiments between
cocultured strain K12 and a bioluminescent S. pyogenes
demonstrated that strain K12 binds avidly to human epithelial cell
lines and can interfere with the binding of S. pyogenes[28,47]
(Figure 3). Oral cavity colonization of humans occurs following
its introduction into the mouth and the efficacy of this
colonization is enhanced by prior reduction of the levels of the
indigenous streptococcal population, as occurs following the use
of an antiseptic mouth rinse (e.g., chlorhexidine) or after
antibiotic treatment.[15,48,49] Recent, as yet unpublished,
studies have also demonstrated that the use of one lozenge a day
containing 1 billion viable cfu of strain K12, is sufficient to
achieve oral cavity colonization in the majority of subjects
[WESCOMBE PA ET AL., UNPUBLISHED DATA]. Further evidence for the
protection afforded by strain K12 against streptococcal
pharyngitis was gathered during a small preliminary trial in which
24 children with a history of recurrent tonsillitis (0.33 episodes
per month) received daily doses of either strain K12 or a placebo.
The 18 children receiving strain K12 experienced fewer sore
throats (0.10 per month) than did the six children in the placebo
group (0.19 per month) [BURTON JP ET AL., UNPUBLISHED DATA].  
  
S. salivarius, Rothia mucilaginosa and an uncharacterized species
of Eubacterium were identified as being present in either
relatively reduced numbers or absent in tongue dorsum populations
of subjects suffering from halitosis.[50] Prompted by this
observation, a trial of 23 subjects with halitosis (having breath
scores for volatile sulfur compound [VSC] levels of greater than
200 ppb) undertook a 3-day regimen of chlorhexidine mouth rinsing,
followed, at intervals, by the use of lozenges containing either
S. salivarius K12 or placebo.[49] Assessment of the subjects' VSC
levels 1 week after treatment initiation demonstrated that 85% of
the K12-treated group and 30% of the placebo group had substantial
(>100 ppb) VSC level reductions. While the majority of the
subjects tested had a favorable outcome, the mechanism(s) of VSC
reduction was not clearly established. In vitro tests showed that
the inhibitory spectrum of strain K12 encompasses some of the key
Gram-negative anaerobes (including Prevotella spp.) that have been
implicated in halitosis.[49] Other mechanisms of competition
(e.g., saturation of attachment sites by the newly introduced K12
cells) may also have been influential, particularly as facilitated
by the chlorhexidine pretreatment step, which may have reduced
populations of some critical adjunct members of the
halitosis-associated consortia. Subsequent colonization of the
microbe-depleted site by the incoming K12 could also limit
anaerobe proliferation through specific BLIS-mediated inhibition
of key members of the halitosis-associated microbiota.  
  
OM is the most common bacterial infection in young children and
the predominant etiological agents are Streptococcus pneumoniae,
S. pyogenes, Moraxella catarrhalis and Haemophilus influenzae. As
a preliminary experiment to evaluate the efficacy of probiotic
interventions for the control of OM, it was shown that S.
salivarius K12, when given to 19 young OM-susceptible children
following a 3-day course of amoxicillin, led to colonization of
the nasopharynx and/or the adenoid tissue of some subjects.[51]
Interestingly, in that study, only 33% of the subjects achieved
oral colonization with strain K12. This lower-than-anticipated
level of colonization was attributed to the failure of the
amoxicillin pretreatment to effect a substantial reduction in the
level of the indigenous oral streptococcal populations, since most
of these subjects had been preconditioned to regular amoxicillin
exposure during the course of their OM therapy.[51] To determine
whether delivery of the S. salivarius K12 probiotic to the oral
cavity would have any effect on the rate of recurrence of OM, a
small study was undertaken at Dunedin Hospital BURTON JP ET AL.,
UNPUBLISHED DATA. The 13 children enrolled in the study were from
the surgical waiting list for grommet implants and all had a
history of recurrent acute OM (AOM). The subjects were offered a
three-month treatment course of either strain K12 or placebo and
nine completed the study. The children receiving the K12 probiotic
(n = 6) had far fewer ear infections (0.22 per month) than they
did prior to entering the study (0.50 per month, n = 13) and also
by comparison with the smaller placebo group (0.55 occurences per
month, n = 3) BURTON JP ET AL., UNPUBLISHED DATA. The encouraging
results of this study (although only preliminary) indicate that S.
salivarius K12 dosing could potentially reduce the occurrence of
OM.  
  
An unanticipated application of S. salivarius K12 could be to
ameliorate the development of oral candidosis. A number of early
studies indirectly demonstrated that S. salivarius may inhibit
oral candida,[52a55] but more recently Ishijima et al.[20] found a
direct protective effect against Candida albicans after oral
dosing with strain K12. In this latest study, K12 was shown to
bind preferentially to the hyphae of C. albicans and to prevent
its attachment to a plastic substratum. Interestingly, K12 was not
able to directly inhibit C. albicans in a deferred antagonism
assay, indicating that the bacteriocins encoded for by strain K12
do not target yeast and further supporting other observations that
mechanisms other than the ability to target pathogens with
antimicrobial molecules can also contribute to the health benefits
of probiotics. When tested using an in vivo mouse model for oral
candidosis, a dose-dependent improvement in symptom score was
observed for mice dosed with K12 at 24 and 3 h before and at 3, 24
and 27 h after C. albicans inoculation, when compared with mice in
a saline-treated group. Follow-up clinical evaluation of the
efficacy of K12 in candidosis control in humans now seems
imperative.  
  
Although it is now well established that exposure to probiotic
bacteria can impact upon the host's immune system, the outcome of
these interactions can be quite strain-specific. Several in vitro
cell culture experiments have indicated that strain K12 can help
to maintain cell homeostasis. In one microarray-based study, it
was demonstrated that co-culture with either strain K12 or certain
bacterial pathogens differentially influenced the expression
levels of 1530 genes in human bronchial epithelial cells.[56]S.
salivarius K12 altered the expression of 660 genes (572 of which
were specific to K12) and, in particular, those involved in innate
immune defense pathways, general epithelial cell function and
homeostasis, cytoskeletal remodeling, cell development and
migration, and signaling pathways. In this same study,
Staphylococcus aureus influenced the expression of 323 genes. The
ratio of upregulated to downregulated genes was 5:2 for K12, but
this ratio was reversed for S. aureus, further illustrating the
different signaling roles of strain K12 and bacterial pathogens.
Closer analysis of the affected gene pathways indicated that K12
potentially contributes to the maintainance of homeostasis between
human and bacterial cells by reducing proinflammatory responses.
In particular, K12 was shown, by enzyme-linked immunosorbent
assay, to reduce the levels (from 318 to 5.1 pg/ml) of the
cytokine IL-8 produced by the bronchial cell line in response to
the presence of Pseudomonas aeruginosa.[56] IL-8 has been
demonstrated to have a major involvement in the pathogenesis of
gingivitis and so dosing with strain K12 may potentially help
ameliorate some of the inflammatory manifestations of this
disease. The secretion of Gro-I+/-, an inducible neutrophil
chemotactic factor synthesized in epithelial tissues during
inflammation, was also inhibited by the presence of strain K12
when the epithelial cells were exposed to flagellin (a known
inducer of IL-8 secretion by epithelial cells), further
emphasizing the protective role strain K12 can play for the host.
The mechanism of immunosuppression by strain K12 appeared to be at
least partially explained through the inhibition of activation of
the NF-IoB pathway (a family of transcription factors that function
as dimers and regulate genes involved in immunity, inflammation
and cell survival). Interestingly, the most significantly
over-represented pathway in the array studies was the unified
interferon signaling pathway. In this pathway, type I and II
interferons signal through their specific receptors to upregulate
the expression of a large number of genes responsible for innate
immunity against viral infection, antitumor activity, priming of
the LPS response and anti-inflammatory effects. This indicates
that, while K12 cells can act to reduce inflammation, they may
also 'prime' the epithelial cells through tonic signaling to
respond rapidly and appropriately to the detection of viral or
bacterial exposure in order to limit the spread of infection a a
role that has recently been ascribed, in general, to commensal
bacteria.[57]  
  
Other preliminary studies have demonstrated that high-level oral
dosing with S. salivarius K12 elicits increased salivary levels of
IFN-I3.[58] These observations were further supported by
investigations with mouse splenocytes, in which IFN-I3 levels, but
not the pro-inflammatory cytokines IL-1I2 or TNF-I+/-, were increased
in response to co-culturing with strain K12 [WALES J ET AL.,
UNPUBLISHED DATA]. Interestingly, it seems that not all S.
salivarius elicit similar immune responses, since S. salivarius
strain ATCC 25975 was reported to upregulate IL-6, IL-8 and TNF-I+/-
gene expression.[59] Indeed, in that study it seemed that strain
ATCC 25975 was even more efficient at inducing the release of
proinflammatory mediators than was C. albicans. These apparently
contradictory findings emphasize the importance of not
extrapolating the specific findings for one probiotic candidate
strain to all members of that same species. The initial findings
of induction by strain K12 of an anti-inflammatory response have
subsequently been independently corroborated by Guglielmetti et
al.,[47] who showed that IL-6, IL-8 and TNF-I+/- levels were
significantly reduced when FaDu cells were co-cultured with K12.
These findings will be discussed below in relationship to the
probiotic candidate strain S. salivarius ST3.  
  
In summary, it appears that strain K12 is well suited for use as
an oral cavity and upper respiratory tract probiotic due to its
natural propensity to inhabit the human oral cavity and be
strongly competitive with a number of potential oral pathogens
that have adapted to the same ecological niche. In addition, the
immune responses of cell lines to co-incubation with S. salivarius
K12 indicate that it elicits no proinflammatory response but
rather an anti-inflammatory response, as well as modulating genes
associated with adhesion to the epithelial layer and homeostasis.
By these strategies, S. salivarius K12 appears to be
well-tolerated on the epithelial surface, while also actively
protecting the host by BLIS-mediated inhibition of pathogen
replication and stimulation of cytokine-mediated reduction of
virus replication and pathogen-induced inflammation and apoptosis.  
  
**S. salivarius M18**  
Some early reports indicated that certain S. salivarius strains
(especially TOVE-R as aforementioned) may have a role in the
limitation of dental caries. Following the successful discovery
and introduction of the probiotic strain K12, BLIS Technologies
Ltd. conducted extensive follow-up deferred antagonism testing of
candidate BLIS-producing S. salivarius to identify strains having
inhibitory spectra that included bacterial species putatively
associated with the development of dental caries. In this screen,
S. salivarius strain M18 (formerly known as Mia) was found to
inhibit all tested S. mutans and S. sobrinus (collectively
referred to as the mutans streptococci). Other species inhibited
by strain M18 included: Actinomyces viscosus, Actinomyces
naeslundii, Streptococcus agalactiae, Streptococcus pneumoniae,
Enterococcus faecalis, Listeria monocytogenes, H. influenzae,
Staphylococcus saprophyticus and Staphylococcus cohnii.[101] This
unusually broad spectrum of inhibition indicated that strain M18,
in addition to potentially reducing the risk of dental caries, may
also have additional benefits for the host in helping to limit the
growth of a variety of common bacterial pathogens of the upper
respiratory tract.  
  
To date, four bacteriocin loci have been identified in the M18
genome: salivaricin A2,[101] 9,[60] MPS[30] and M.[30] Salivaricin
A2 and 9 are well-characterized bacteriocins with broad activity
against S. pyogenes as well as other upper respiratory tract
pathogens, but not against mutans streptococci. Salivaricin MPS is
less well characterized, but is known to be a large 60 kDa
bacteriocin with specific activity against S. pyogenes.[61]
Salivaricins A2, 9 and MPS have been found to be
megaplasmid-encoded in strain M18.[16,30] By contrast, salivaricin
M appears to be chromosomally encoded and, recently, has not only
been shown to be a lantibiotic, but also to be the molecule
responsible for the observed activity of strain M18 against mutans
streptococci.[30] Interestingly, unlike most other S. salivarius
bacteriocins, salivaricin M appears to be optimally produced in
vitro on TSYCa agar (trypticase soy broth supplemented with 2%
yeast extract, 0.1% CaCO3 and 1.5% agar), and less effectively on
BaCa (blood-containing) agar in deferred antagonism assays, an
observation indicating that there is strict regulation of its
locus expression.  
  
Preliminary colonization trials have indicated that, in children
who colonize well with strain M18, the salivary levels of mutans
streptococci are maintained at reduced levels for significant
periods (at least 27 days) by comparison with placebo-dosed
control subjects, in whom the mutans streptococci levels returned
to pretreatment levels within 4a6 days.[101,62]  
  
A variety of pathogens have been implicated in the development of
gingivitis and periodontitis and it has also been shown that the
etiology of these diseases is strongly linked to the inflammatory
response of the host cells to the bacterial pathogens.[63,64] To
determine whether strain M18 can potentially impact on
pathogen-induced pro-inflammatory cytokine expression in gingival
fibroblasts, strains M18 and K12 were coincubated with gingival
fibroblasts both prior to and concommitantly with exposure to
periodontal pathogens such as Porphyromonas gingivalis,
Aggregatibacter actinomycetemcomitans and Fusobacterium nucleatum.
Strains M18 and K12 both significantly inhibited the expression of
the pro-inflammatory cytokines IL-6 and -8, commonly associated
with gingivitis a indicating that dosing with these probiotics may
potentially be useful in the treatment of gingivitis.[65]
Appropriately controlled large-scale clinical trials further
investigating the potential for M18 probiotic interventions in the
control of dental caries and gingivitis now appear warranted.  
  
**New Nominations****S. salivarius ST3**  
  
...Ability to produce urease was another characteristic assessed
for each of the candidate probiotic strains. Strains K12 and RS1
were demonstrated both to be strongly ureolytic, a trait
considered beneficial due to its effect in reducing the acidity of
dental plaque and, thereby, possibly delaying the onset and
progression of dental caries.[70,71] By contrast, strain ST3
appeared non-ureolytic and, on further examination, was found to
lack ureC, which encodes the main subunit of the urease
complex.[18] The authors suggested that the inability to hydrolyze
urea could be considered beneficial, in that it could result in
there being less damage to the host's mucosal cells from exposure
to ammonia. These observations highlight the potential for
different strains to fulfill different roles in the oral cavity
and, perhaps, for them to be targeted to applications in
individuals with specific health needs....  
  
...Both strains were also found to grow efficiently in milk,
indicating that fermented milk products may be suitable delivery
vehicles for the probiotics.[19]  
  
**S. salivarius 24SMB**  
  
**S. salivarius T30**  
  
**Future Perspective**  
With the recent rapid expansion in the variety of available
probiotics and in their delivery vehicles, consumers are
developing a growing enthusiasm for the health benefits to be
derived from their consumption. While the majority of probiotics
have been designed for use in the GI tract, it is clear that there
is now an impetus to progress the field to encompass other regions
of the body, including the oral cavity. As this review has shown,
there are now a number of candidate probiotic strains from the
species S. salivarius that have been proposed for application to
the control of microbial diseases of the oral cavity. While the
safety of S. salivarius for application to humans appears to have
been well established, there is still only relatively limited
clinical evidence to support claims of health benefit. Most
current supporting evidence has been based on either in vitro
studies or the results of clinical trials that have been limited
in size. There is no doubt that, in the next few years, the
benefits to be gained from these probiotics (both in terms of
health and commercial gain) will provide the incentive for
clinical studies of sufficient magnitude to clearly establish the
roles that S. salivarius probiotics can play in the human oral
cavity, the upper respiratory tract and beyond (Figure 4). It is
also apparent that, due to strain variation (even in the
immunological responses that they evoke), individual strains will
be selected for their specific health benefits which could include
the prevention of: dental caries; OM; streptococcal sore throat;
halitosis; oral thrush; general immune priming and potentially
many more (Table 1). This promises to be a rapidly evolving and
rewarding research area to observe and to participate in over the
next decade.  
  


---

  
[**http://www.blisk12.com/tag/lozenges/**](http://www.blisk12.com/tag/lozenges/)

**BLIS K12, A futuristic supplement that is
here and now**

  
Just imagine popping an Altoid-type mint into your mouth, and
while refreshing your breath, it also supplies beneficial bacteria
to build a protective barrier in your mouth that can help support
your upper respiratory system health.  Though that may seem
like a concept from the future, the future is actually here and
now.  Oral probiotic, BLIS K12A(r), adds pertinent agood
bacteriaa to the oral cavity and is the first of its kind to
target this area of the body.  It was discovered by Dr. John
Tagg of the University of Otago, when studying the mouths of
individuals who had exceptional oral and upper respiratory health.  
  
Scientific research continues to expand our knowledge of the
bacteria that inhabit our intestinal tract and the substantial
benefits from probiotic supplementation.  However, we are now
beginning to gain an understanding of the importance of the
bacteria that reside in other parts of our bodies such as our oral
cavity, and how probiotic supplementation targeted to this area
can play a crucial role in supporting overall health.  The
BLIS K12A(r) oral probiotic can help maintain health in the mouth
(breath, teeth and gums), throat, and inner ear.  
  
Supplements containing BLIS K12A(r) can be found internationally in
the form of chewing gum, lozenges, fast-melt tablets, chewable
tablets, and powders.   
  


---

  

**Patents**

  
**US8057790****TREATMENT OF MALODOUR****NZ546406** **Treatment of halitosis with BLIS-producing S. salivarius****US6773912** **Lantibiotic****WO2004072272****BACTERIAL COMPOSITIONS****NZ536689****Streptococcus salivarius strain and extract having
anti-mutans Streptococci activity** **[ Excerpts ]**

**TW200400262**  
**Antimicrobial composition**

  
This invention provides novel Streptococcus salivarius,
compositions containing same, and use of S. salivarius strains as
antimicrobial agents. The strains are bacterial inhibitors with
respect to at least S. mutans and/or MS and therefore have a
number of therapeutic applications. The applications include but
are not limited to forming part of therapeutic formulations for
use in controlling, treating, or preventing dental caries.  
  
**BACKGROUND**   
  
Dental caries is a disease characterised by dissolution of the
mineral portion of the tooth. As caries progresses, destruction of
tooth enamel and dentine occurs followed by inflammation of pulp
and periapical tissues.  
  
The mutans streptococci (MS) are a cluster of acidogenic, dental
plaque-inhabiting streptococcal species that are considered the
principal causative agents of caries. Presently, seven different
MS species (known as S. mutans, S. rattus, S. cricetus, S.
sobrinus, S. ferus, S. macacae, and S. downei) are recognised. Of
these seven species it is mainly S. mutans and S. sobrinus that
are of significance in terms of human caries.  
  
Over the years various methods have been developed and tried with
varying results, to prevent or at least alleviate the problem of
dental caries. Treatments with antibiotics such as penicillin have
been suggested and are effective but indiscriminately destroy both
useful and harmful bacteria in the mouth leading to microbial
imbalances.  
  
In order to minimise disruption to the mouth microflora,
antibiotic producing organisms have been investigated for their
ability to inhibit caries. A group of organisms identified as
having potential in this regard are microorganisms producing
bacteriocin-like inhibitory substances (BLIS). BLIS producers of
the genera Streptococcus, Staphylococcus and Enterococcus have
been screened for potential application to prevention of dental
caries (Balakrishnan, M. et al., Caries Res. 2001 ; 35: 75-80).  
  
What is sought is a non-virulent analog of the disease-causing S.
mutans, or a so called effector strain. To serve as an effector
strain in replacement therapy in bacterial infection, the
microorganism must be non-virulent itself and able to compete
successfully with the pathogenic microorganism either via
competitive action and/or antibiotic action. S. mutans effector
strains have been identified (Hillman et al. , J Dent Res. 1987;
66: 1092-4; James and Tagg, N Z Dent J. 1991; 87: 80-3) and show
strong anti-S. mutans activity. A disadvantage with the use of S.
mutans effector strains is the cariogenic potential of these
strains.  
  
S. salivarius is an alternative streptococcus species which avoids
this disadvantage. In WO 01/27143 S. salivarius strains are
identified which have utility in the treatment of dental caries
caused at least in part by S. sobrinus. No activity was recorded
against MS generally or S mutans in particular. Similarly, in
Balakrishnan (supra), S. salivarius K3 is identified as active
against S sobrinus when grown on trypticase soy broth yeast
extract calcium carbonate agar medium, but had no effect on S.
mutans.  
  
S. salivarius TOVE-R (Tanzer, J. M. et al.; Infect Immun. , 1985,
48 : 44-50) is an antagonist strain and which brought about a
reduction in dental caries. There have been no reports of BLIS
production by this strain.  
  
The applicants have now identified BLIS-producing S. salivarius
strains with a broad spectrum of activity against MS dental caries
causing organisms including S. mutans.  
  
The present invention is broadly directed to these novel S.
salivarius strains, and the use of anti-MS S. salivarius strains
in the treatment of dental caries, or at least provides the public
with a useful choice.  
  
**SUMMARY OF THE INVENTION**   
Accordingly, in one aspect, the present invention may broadly be
said to consist in a biologically pure culture of a Streptococcus
salivarius strain which is a Salivaricin A2 producer and which
exhibits anti-MS activity, with the proviso that the strain is not
S. salivarius K12 (Kl2).  
  
In another aspect, the invention provides a biologically pure
culture of a Streptococcus salivarius strain which is a
Salivaricin A2 producer, exhibits anti-MS activity, and for
carbohydrate metabolism is positive for at least one of
L-arabinose, inulin, glycogen, xylitol, and (3-gentiobiose use, or
(3-galactosidase production; and/or is negative for at least one
of glycerol, a-methyl-D-mannoside use, or alkaline phosphoaase
production.  
  
Preferably, the strain is positive for each of L-arabinose,
inulin, glycogen, xylitol, and ss- gentiobiose use, or
p-galactosidase production; and/or is negative for each of
glycerol, a- methyl-D-mannoside use, or alkaline phosphatase
production.  
  
The invention further provides a biologically pure culture of
Streptococcus salivarius strain Mia on deposit at Deutsche
Sammlung von Mikroorganismen Und Zellkulturen GmbH, Mascheroder
Weg 1 b, D-38124, Braunschweig, Germany, Accession No. DSM 14685,
or a culture having the identifying characteristics thereof.  
  
The invention also provides an extract obtainable from Salivaricin
A2-producing strains of S. salivarius, which extract has anti-MS
activity. In particular, the extract has anti-S. mutans activity.
Conveniently, the extract is obtainable from S. salivarius strains
Mia or K12.  
  
In a further aspect, the present invention provides an
antibacterial composition which includes an S. salivarius or
extract as defined above.  
  
In a still further aspect, the present invention provides a
therapeutic formulation comprising an S. salivarius or extract as
defined above, together with a diluent, carrier and/or excipient.  
  
In one embodiment, the composition or formulation further
comprises a secondary antibacterial agent.  
  
In one embodiment, the therapeutic formulations are in the form of
foods or drinks, preferably in the form of a dairy product-based
food or drink. Alternative forms are medicaments, lozenges and
confectionaries.  
  
The invention further provides a method for at least inhibiting
the growth of bacteria sensitive to S. salivarius of the
invention, the method comprising contacting the sensitive bacteria
with an inhibitory effective amount of an S. salivarius, extract
or composition or formulation of the invention.  
  
Preferably the sensitive bacteria are MS, and more preferably S.
mutans.  
  
The invention provides in another aspect a method for at least
inhibiting the growth of MS or S. mutans, the method comprising
contacting the MS or S. mutans with an inhibitory effective amount
of : (i) an S. salivarius extract composition or formulation of
the invention; or (ii) S. salivarius K12 or an anti-MS or anti-S.
mutans active extract therefrom, or a composition or formulation
comprising K12 or an active extract therefrom...  
  
DETAILED DESCRIPTION OF THE INVENTION   
  
As noted above, the present invention is directed in a first
aspect to Streptococcus salivarius strains which produce
Salivaricin A2 and which exhibit anti-MS activity. When grown on
TSBCaYE agar, the S. salivarius strains desirably exhibit activity
against a broader spectrum of MS including S. mutans. Salivaricin
A2 and an A2-producing S. salivarius strain (strain K12) are
described for example in WO 01/27143 incorporated herein by
reference.  
  
In one embodiment the invention is directed to S. salivarius
strain Mia and S. salivarius strains having the identifying
characteristics thereof.  
  
Strain Mia is distinct from strain K12 in its biochemical
characteristics as determined using API 20 Strep kit (bioMerieux)
and API 50 CH (bioMerieux) which allow study of the carbohydrate
metabolism. The differences are summarised as follows: API 20
Strep kit MIA K12 p-galactosidase + Alkaline phosphatase-+ API 50
CH Glycerol-+ anaerobic L-arabinose + a-methyl-D-mannoside-+
aerobic Inulin + Glycogen + Xylitol + p-gentiobiose + Preferably,
strains for use in the invention exhibit at least one, preferably
at least three, more preferably at least six, and even more
preferably all of the distinguishing biochemical characteristics
of strain Mia.  
  
Mia also exhibits stronger anti-MS, and in particular stronger
anti-S. mutans activity than K12.  
  
S. salivarius strain Mia is a BLIS-producing strain with activity
against other bacteria, particularly streptococci, and more
particularly MS, including S. mutans. S. salivarius strain Mia was
deposited with Deutche Sammlung von Mikroorganismen Und
Zellkulturen GmbH, Mascheroder Weg 1 b, D-38124, Braunschweig,
Germany on 12 December 2001 and has been assigned Accession No.
DSM 14685.  
  
As noted above MS are considered the primary causative agents in
dental caries with S. mutans being of particular significance.
While BLIS-producing strains of S. salivarius active against
streptococci have been reported previously, this is the first time
that BLIS producing S. salivarius active against MS and S. mutans
in particular, have been identified.  
  
The S. salivarius strains of the invention exhibit broad spectrum
antibacterial activity, particularly when grown on TSBCaYE agar
media. The S. salivarius are therefore useful as antibacterial
agents per se as well as therapeutically. In this
context,"therapeutic"includes prophylactic treatment. Therapeutic
uses include the treatment or prevention of microbial infections,
especially streptococcal infections. The salivarius'of the
invention are particularly suitable for use against MS and S.
mutans. Conditions amenable to treatment with the strains or
extracts of the invention include dental caries, sore throats, and
bad breath.  
  
The invention also relates to extracts obtainable from salivaricin
A2-producing strains of S. salivarius and especially from strains
of the invention. These active extracts may similarly be used in
therapeutic formulations and methods. Extracts can be obtained
using known art protocols, conveniently by cell culture and
centrifugation...  
  
One preferred formulation employs freeze dried S. salivarius of
the invention in milk powder formulations in a manner similar to
that previously reported for the preparation of Bifidus Milk
Powder (Nagawa et al. (1988); J. Dairy Sci. 71: 1777-1782).  
  
One orally administrable formulation of S. salivarius is a blend
of freeze dried S. salivarius strains with skim milk powder or the
like which has been flavoured to enhance palatability...  
  
The formulations and compositions of the invention may further
comprise one or more secondary antibacterial agents. These
secondary agents may, for example, be antibiotics, or other
antibacterial agent or antibacterial producing microorganisms.
Useful antibacterials include nisin, and other BLIS for example.
Preferably, the secondary antibacterial agent is a BLIS or BLIS
producing microorganism. The BLIS may be one or more of
salivaricin A, Al, A2 and B. Other antibacterial microorganisms
include known S. salivarius such as K12 and K30.  
  
S. salivarius strains of the invention are primarily found on the
tongue surface. Combinations with S. salivarius that grow in
dental plaque such as TOVE-R (supra) would be useful...  
  
A currently preferred treatment protocol for dental caries
comprises pre-treatment by brushing teeth with chlorhexidine gel
for 2 to 5 days, preferably 3 days. A lozenge is administered 1-4
hours, preferably 2 hours after the gel. This is followed by
administration of a further 2-5, preferably 3 lozenges through the
day at intervals of 1-4 hours, preferably every 2 hours. This
protocol is followed for 2-4 days to facilitate colonisation. For
maintenance purposes 1, 2, or 3 lozenges, usually 1 to 2 lozenges
are taken each day following ordinary tooth brushing. The regime
is continued for as long as required...  
  
**EXPERIMENTAL**   
Identification -- Strain Mia was isolated from the oral cavity of
a healthy adult human subject. It grows on Mitis salivarius agar
at 37 C, 5% C02 with morphology typical of S. salivarius as
follows:  
Colony shape and size: round, 1-2 mm in diameter  
Margin (edge): entire (smooth)  
Elevation: convex  
Colour: blue  
Texture: mucoid On Blood agar [Columbia Agar Base (GIBCO) with 5%
human blood] at 37 C, 5% C02 it is not haemolytic, and exhibits
the following morphology :  
Colony shape and size: round, < 1 mm in diameter  
Margin (edge): entire (smooth)  
Elevation: convex  
Colour: white  
Texture: mucoid When cultivated on either Blood agar or on
Trypticase soy broth (BBL) + Davis agar 1.5% supplemented with 0.
1% calcium carbonate the bacterial growth appears relatively more
firmly adherent to the agar surface than is typical of most S.
salivarius. The API 20 Strep Identification code for the strain is
5050451, which corresponds to Streptococcus salivarius (98. 4%
identity)...  
  
**Preparation of anti-MS active extract**   
One hundred ml of molten Trypticase Soy agar containing 2% yeast
extract and 0.25% calcium carbonate was poured into a 1 L schott
bottle. One ml of an overnight culture of S. salivarius MIA, grown
in Todd Hewitt broth at 37 C, in 5% CO2 in air, was added to the
bottle. The culture was incubated anaerobically at 37 C for 18-24
hours. One hundred ml of Trypticase Soy broth containing 2% yeast
extract and 0.25% calcium carbonate was added to the bottle, which
had been preincubated under anaerobic conditions. The culture was
then incubated for a further 24 hours anaerobically at 37 C. The
broth was centrifuged to remove the bacterial cells and then
ammonium sulphate was added to 50% (w/v) and incubated at 4 C for
18 hours. The sample was then centrifuged and the pellet
resuspended in 1 ml of milli-Q water. Anti-MS activity of the
sample was then tested using a well diffusion assay in Blood agar
plates. Fifty 1ll of the sample is added to each well and
air-dried. The plates were then chloroform treated. An overnight
culture of the indicator strain was spread over the top of the
plate and incubated at 37 C, 5% C02 in air, for 18-24 hours...  
  
**INDUSTRIAL APPLICATION**   
The results above demonstrate the antibacterial effect of S.
salivarius strains, particularly strain Mia against a broad
spectrum of microorganisms, particularly streptococci. These
strains are the first BLIS producing S. salivarius to be
identified which have activity against MS, and more particularly
S. mutans. The strains and related active extracts herein
therefore have application in methods of therapeutically treating
individuals against the harmful effects of streptococcus
infection, especially in the oral cavity. These methods include
treatment of dental caries in which MS or S. mutans are the
primary causative agent. The S. salivarius extracts and
compositions of the invention also have application in the
treatment of bad breath and sore throats.  
  


---

  

**US8057790**  
**TREATMENT OF MALODOUR**

  
[ Excerpts ]  
  
**FIELD OF THE INVENTION**  
  
This invention relates to methods of inhibiting growth of
anaerobic bacteria, particularly halitosis causing bacteria, and
to the use of BLIS-producing Streptococcus salivarius strains,
extracts thereof, and compositions containing same in the
prevention or treatment of halitosis.  
  
**BACKGROUND**  
Halitosis or bad breath is a common complaint characterised at
least in part by the production of volatile sulfur compounds. The
production of such compounds is generally associated with oral
bacteria, particularly certain anaerobic species. These bacteria
generally inhabit oral surfaces, and particularly periodontal
pockets and the dorsa of the tongue surface.  
  
The primary source of volatile sulphur compounds (VSC's) from the
subgingival microflora is from microorganisms that can be both
commensal and pathogenic. Previous culture-based studies have
indicated that Porphyromonas gingivalis, Prevotella intermedia
(both black pigmented species, Fusobacterium nucleatum, Micromonas
micros (formerly, Peptostreptococcus), Bacteroides species,
Campylobacter rectus, Eikenella corrodens, Desulfovibrio species,
Treponema denticola, and Eubacterium species amongst others are
responsible for the production of VSC's that contribute to
halitosis (as summarized by Loesche W J, Kazor C. Periodontol
2000. 2002; 28:256-79. and Khaira N, Palmer R M, Wilson R F, Scott
D A, Wade W G. Oral Dis. 2000 November; 6 (6):371-5). However,
recent non-culture healthy or afflicted with halitosis. Atopobium
pavulum, Eubacterium sulci, Fusobacterium periodonticum,
Dialister, a phylotype of streptococci, a phylotype of the
uncultivated phylum TM7, and Solobacterium moorei appeared to be
present in subjects with halitosis. By contrast, Streptococcus
salivarius, Rothia mucilaginosa (Stomatococcus mucilaginosus), and
an uncharacterized Eubacterium (strain FTB41) were commonly
detected only amongst healthy individuals (Kazor, C. E. et al., J.
Clin Microbiol, February 2003, pp 558-563).  
  
Over the years various methods have been developed and tried with
varying success, to prevent or at least alleviate the problem of
halitosis. Current treatments focus on anti bacterial regimes to
reduce numbers of oral bacteria, or agents to mask or neutralise
the offensive odour. Oral rinses with chlorine dioxide (see for
example, WO 95/27472 and U.S. Pat. No. 5,738,840) have been shown
to have some effect in the control of halitosis, but offer only
temporary relief in the order of a few days. Generally, current
methods of treating halitosis require complex physical, chemical
or expensive regimes to be carried out and are typically only of
short term effect, as the malodour-causing oral bacteria recover
to former levels after treatment is stopped.  
  
What is sought to treat halitosis is the replacement of the
disease-causing organisms, with a non-virulent commensal
microorganism. To serve as an effector strain in replacement
therapy, the microorganism must be able to compete successfully
with the pathogenic microorganism either via competitive action
(e.g. for attachment sites), and/or antibiotic action, or
inhibition by other metabolism-associated by-products.  
  
In WO 01/27143 S. salivarius strains are identified which have
utility in the treatment of infections of the upper respiratory
tract caused by streptococcal organisms, including treatment of
sore throats caused mainly by S. pyogenes, and dental caries
caused at least in part by S. sobrinus. No activity was recorded
against any anaerobic microorganisms. Moreover, the treatment of
halitosis is nowhere contemplated in that document.  
  
The present invention is broadly directed to methods of at least
inhibiting growth of anaerobic microorganisms using BLIS-producing
S. salivarius strains or compositions comprising same, or at least
provides the public with a useful choice...  
  
**BRIEF DESCRIPTION OF THE DRAWINGS**  
  
FIG. 1. Example of inhibitory effect of S. salivarius K12 on
black-pigmented bacteria (Prevotella species) from saliva sample.  
  
FIG. 2A. Bar graph showing VSC levels of mouth air from two case
subjects (4 and 12) over 28 days and after treatment.  
  
FIG. 2B. Bar graph showing detection of BLIS activity of
Streptococcus salivarius isolates (%) from case subjects over time
by sensitive indicator microorganism Micrococcus leuteus (I1,
sensitive to SAL A and B).  
  
FIG. 2C. Bacterial counts of saliva from subject 4.  
  
FIG. 2D. Bacterial counts of saliva from subject 12.  
  
**DETAILED DESCRIPTION OF THE INVENTION**  
As noted above, the present invention is directed in a first
aspect to a method for at least inhibiting the growth of anaerobic
bacteria sensitive to BLIS-producing S. salivarius. The method
comprises contacting the sensitive bacteria with an inhibitory
effective amount of a BLIS-producing S. salivarius, or an extract
thereof, or a composition containing the S. salivarius or extract
thereof...  
  
Preferably, the S. salivarius strains for use in the invention are
native Salivaricin B producers with activity against anaerobic
bacteria, particularly black pigmented species (such as
Prevotella), Eubacterium saburreum and/or Micromonas micros.
Salivaricin B BLIS-producing strains with activity against
anaerobic bacteria include K12, and K30 both deposited with
Deutche Sammlung von Mikroorganismen Und Zellkulturen GmbH,
Mascheroder Weg 1 b, D-38124, Braunschweig, Germany on 8 Oct.
1999, and 8 Oct. 1999, and assigned Accession Nos. DSM 13084 and
13085 respectively.  
  
Strain Sal 20P3 was deposited at the Australian Government
Analytical Laboratories, 1 Suakin Street, Pymble, New South Wales,
Australia in July 1992 under Accession No. AGAL 92/32401.  
  
Sal 20P3 is a producer of Salivaricin A only and has activity
against at least Micromonas. Salivaricin B producers K12 and K30
have a broader range of activity against black pigmented species,
Eubacterium and Micromonas at least.  
  
S. salivarius BLIS-producers may be identified by testing
potential producer strains in agar surface assays as taught in WO
01/27143. Production of Salivaricin A, A2 and B may be confirmed
by comparing sequence identity and activity to those sequences and
activity data given in WO 01/27143. For convenience, the amino
acid sequences of Salivaricins useful in the invention are as
follows:  
  
Salivaricin  AminoaAcidaandaNucleicaAcidaSequence  
A  MKNSKDILNNAIEEVSEKELMEVAGG  (SEQaIDaNO:a1)a-1    
  KRGSGWIATITDDCPNSVFVCC   +1    
 
ATGAATGCCATGAAAAACTCAAAAGATATTTTGAACAATGCTATCGAAGAAGTTTCTGA 
(SEQaIDaNO:a2)  
 
AAAAGAACTTATGGAAGTAGCTGGTGGTAAAAGAGGTTCAGGTTGGATTGCAACTATTA 
  
  CTGATGACTGTCCAAACTCAGTATTCGTTTGTTGTTAA    
A1  MKNSKDILTNAIEEVSEKELMEVAGG  (SEQaIDaNO:a3)-1   
  KKGSGWFATITDDCPNSVFVCC +1    
 
ATGAGTTTTATGAAAAATTCAAAGGATATTTTGACTAATGCTATCGAAGAAGTTTCT 
(SEQaIDaNO:a4)  
 
GAAAAAGAACTTATGGAAGTAGCTGGTGGTAAAAAAGGTTCAGGTTGGTTTGCAACT    
  ATTACTGATGACTGTCCGAACTCAGTATTTGTTTGTTGTTAA    
A2  atgaattagccaatgaaaaaaacatcaaaaaagataattattgaaacaaat 
(SEQaIDaNO:a5)  
  MetaIleaAlaaMetaLysaAsnaSeraLysaAspaIleaLeuaAsnaAsn 
(SEQaIDaNO:a6) 
getaatcagaaagaaagttatctagaaaaaaagaaacttaatgagaaagta    
  AlaaIleaGluaGluaValaSeraGluaLysaGluaLeuaMetaGluaVal    
  gctaggtaggtaaaaaagaaggtaacaaggtatggatttagcaaactaatt    
  AlaaGlyaGlyaLysaArgaGlyaThraGlyaTrpaPheaAlaaThraIle 
  aaaaaaaaa-1aa+1    
  actagatagacatgtaccaaaacatcaagtaattcagttatgtatgtataa    
  ThraAspaAspaCysaProaAsnaSeraValaPheaValaCysaCys    
B  ttgaactacttagaaagaaacttagataaacagttacttaggtagetaggt 
(SEQaIDaNO:a7)  
  LeuaThraLeuaGluaGluaLeuaAspaAsnaValaLeuaGlyaAlaaGly 
(SEQaIDaNO:a8)  
  aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa-1aa+1    
  ggtaggaagtaaatcacaaaaccaattatcaacacagaaatgtacgtaatg    
  GlyaGlyaValaIleaGlnaThraIleaSeraHisaGluaCysaArgaMet    
  aacatcaatggacagattcattgatttaactatgtatgcatctataa    
  AsnaSeraTrpaGlnaPheaLeuaPheaThraCysaCysaSer  
  
The sequence for Salivaricin A1 is also given as a further BLIS
useful in the invention...  
  
As noted above black pigmented species, Eubacterium and Micromonas
are considered causative agents in halitosis. While the
BLIS-producing strains of S. salivarius above are known to be
active against gram-positive aerobic bacteria, their activity
against anaerobic bacteria, such as black pigmented species,
Eubacterium and Micromonas in particular, is unexpected. All the
more so because BLIS-producing organisms are typically known to
act against more closely related species.  
  
These BLIS-producing S. salivarius are therefore useful as
anaerobic antibacterial agents per se as well as therapeutically.
In this context, atherapeutica includes prophylactic treatment.
Therapeutic uses include the treatment or prevention of anaerobic
microbial infections, especially Eubacterium and Micromonas
infections, and infections by black pigmented species. The S.
salivarius are particularly suitable for use against Prevotella
species including P. intermedia and P. melaminogenica; Eubacterium
saburreum, Micromonas micros, Streptococcus anginosus, some or all
of which may be implicated in halitosis. Conditions amenable to
treatment with the S. salivarius strains include halitosis (or bad
breath).  
  
Extracts obtainable from the BLIS-producing salivarius strains are
also useful in the invention. Extracts include those in which the
BLIS or BLIS' produced by the salivarius strain is/are provided in
isolated or pure form. An aisolateda BLIS is one which has been
identified and separated and/or recovered from its natural
cellular environment. Extracts can be obtained using known art
protocols, conveniently by cell culture and centrifugation.
Routine isolation methods include ammonium sulphate precipitation,
column chromatography (e.g. ion exchange, gel filtration, affinity
chromatography etc.), electrophoresis, and ultimately,
crystallisation (see generally aEnzyme Purification and Related
Techniquesa. Methods in Enzymology, 22: 233-577 (1991)). The BLIS
may be purified as necessary using conventional techniques (see
for example, Parente, E and Ricciardi, A. Applied Microbiol.
Biotechnol 52: 628 (1999))..  
  
**EXAMPLES****Deferred Antagonism Test of Anti-Bacterial Activity**  
**Effect of S. Salivarius K12 Extract on Bacteria**  
  
S. salivarius K12 was grown in skim milk powder broth at 33A deg C.
for 18 h. The bacterial cells were harvested by centrifugation and
freeze-dried. One gram of freeze-dried cells were incubated in 10
ml of 95% methanol, pH 2.5 at room temperature for 2 h. The
preparation was centrifuged to remove undissolved material. The
toxicity of the supernatant was tested using a well diffusion
assay.  
  
**Inhibition of Black-Pigmented Bacteria (Prevotella Species) in
Saliva by S. Salivarius Strains**  
**Effect of S. salivarius K12 on Halitosis Subjects****Subjects, Treatment, Probiotic Instillation and Sample
Collection**  
  
**Saliva Analysis****Culture Analysis**  
  
**Results****Inhibitory Effect**  
  
The testing of Streptococcus salivarius strains that were
non-producers of salivaricins or that produced either salA and
salB, salA only, salB only against some of the bacterial species
implicated in halitosis showed that only the gram-positive
bacteria were affected when tested by deferred antagonism (Table
1)...  
  
**INDUSTRIAL APPLICATION**  
BLIS-producing S. salivarius strains, particularly salivaricin B
producing strains are active against a number of microorganisms
implicated in halitosis (Tables 1, 2 and 6). More particularly,
the strains are shown for the first time to be active in a
maintenance regime, that is, for generating a cumulative effect
against at least some anaerobic halitosis-causing organisms over a
period of a week or more. This is surprising where generally S.
salivarius strains are thought to be active against only closely
related aerobic organisms. Halitosis-causing organisms are
anaerobic and occupy niches not generally accessed by S.
salivarius, The strains and related active extracts, formulations
and compositions herein therefore have application in methods of
prophylactically or therapeutically treating individuals against
the harmful effects at least of some Eubacterium and Micromonas
infections, as well as some black-pigmented colony types,
especially in the oral cavity. These methods include treatment of
halitosis in which these organisms are the primary causative
agents. The S. salivarius extracts and compositions of the
invention also have application in the treatment of sore throats.  
  
It will be appreciated that the above description is provided by
way of example only and that variations in both the materials and
techniques used which are known to those persons skilled in the
art are contemplated.  
  
**REFERENCES**  
  
1. Bosy, A., G. V. Kulkarni, M. Rosenberg, and C. A. McCulloch.
1994. Relationship of oral malodor to periodontitis: evidence of
independence in discrete subpopulations. Periodontol 65:37-46.  
2. Burton, J. P., and G. Reid. 2002. Evaluation of the bacterial
vaginal flora of 20 postmenopausal women by direct (Nugent score)
and molecular (polymerase chain reaction and denaturing gradient
gel electrophoresis) techniques. J Infect Dis 186:1770-80.  
3. De Boever, E. H., and W. J. Loesche. 1995. Assessing the
contribution of anaerobic microflora of the tongue to oral
malodor. J Am Dent Assoc 126:1384-93.  
4. Kazor, C. E., P. M. Mitchell, A. M. Lee, L. N. Stokes, W. J.
Loesche, F. E. Dewhirst, and B. J. Paster. 2003. Diversity of
bacterial populations on the tongue dorsa of patients with
halitosis and healthy patients. J Clin Microbiol 41:558-63.  
5. Tagg, J. R., and L. V. Bannister. 1979. aFingerprintinga
beta-haemolytic streptococci by their production of and
sensitivity to bacteriocine-like inhibitors. J Med Microbiol
12:397-411.  
6. Walter, J., G. W. Tannock, A. Tilsala-Timisjarvi, S. Rodtong,
D. M. Loach, K. Munro, and T. Alatossava. 2000. Detection and
identification of gastrointestinal Lactobacillus species by using
denaturing gradient gel electrophoresis and species-specific PCR
primers. Appl Environ Microbiol 66:297-303.  
7. Yaegaki, K., and J. M. Coil. 2000. Examination, classification,
and treatment of halitosis; clinical perspectives. J Can Dent
Assoc 66:257-61.   
  


---

  
**Related Patents :**  
  

**CN104398537**  
**Oral probiotic composition**

Inventor(s): CHEN XIANGDONG; WANG HUI; LIU XIAOWEN  
The invention relates to an oral probiotic composition, which
contains Streptococcus salivarius K12, and one or more of the
Chinese herb extract effective ingredients eugenol, tea
polyphenol, glycyrrhizic acid, menthol, radix scrophulariae total
glycoside, hericium erinaceus polysaccharide, Pachymaran, a dark
plum water extract, and pueraria isoflavone. The composition can
adjust oral flora balance, clean the oral cavity and improve oral
air, and also has the efficacy of diminishing inflammation and
relieving sore swollen throat.  
  

**US8506953**  
**USE AND METHODS FOR PREVENTING AND/OR TREATING ORAL MALODOUR**

Inventor(s): BOETTNER MEWES; LANG CHRISTINE; VEEN MARKUS;
SCHILLING MICHAEL; REINDL ANDREAS  
Described is a microorganism belonging to the group of lactic acid
bacteria which is able to drastically reduce the peptide
concentration in saliva thereby depleting the substrate used by
anaerobic microorganisms of the oral micro-flora which are the
causative agent for oral malodour. Moreover, described is a
microorganism belonging to the group of lactic acid bacteria which
is able to stimulate the growth of Streptococcus salivarius but
does not stimulate the growth of Streptococcus mutans and/or
Porphyromonas gingivalis. Also described are compositions
containing the above-mentioned microorganisms, their use for
preventing and/or treating oral malodour and/or halitosis and to
methods for preventing and/or treating oral malodour and/or
halitosis  
  

**UA54411**  
**Method for treatment of patients with chronical generalized
periodontitis**

Inventor(s): NEPORADA KARINE STEPANIVNA, et al.  
A method for treatment of patients with chronical generalized
periodontitis provides the prescription of conventional therapy
and probiotic, containing bifidobacteria and lactobacilli of
Lactobacillus acidophilus type. As a probiotic the multifunctional
resistent to antibiotics mylbtipobiotik "Simbiter TM acidophilous
concentrated" multiprobiotic, which contains the following
bifidobacteria varieties: Bifidobacterium bifidum and B. longum,
and additionally it comprises the following lactobacilli
varieties: Lactobacillus delbrueckii subsp. bulgaricus and L.
helveticus, as well as lactic streptocokkes of Lactococcus lactis
and Streptococcus salivarius ssp. Thermophilus varieties,
propionic bacteria of varieties of Propionibacterium
freudenreichii and Propionibacterium acidipropionici and acetic
bacteria of variety Acetobacter aceti, and the multiprobiotic is
prescribed topically using individual dentoalveolar caps for
night, and internally one doze per day.  
  

**CA2791427**  
**COMPOSITION COMPRISING STREPTOCOCCUS SALIVARIUS USEFUL IN THE
TREATMENT OF INFECTIONS AND/OR INFLAMMATIONS OF THE UPPER
RESPIRATORY TRACT**

Inventor(s): STEFANI STEFANIAa[IT]; TIBERI LICIAa[IT]; SANTAGATI
MARIA  
The present invention provides a new microbial strain of the
species Streptococcus salivarius for use in the treatment of
inflammatory processes with or without infectious etiology. A
further object of the present invention compositions comprising
said strain and uses thereof.  
  

**KR20120049488**   
**PHARMACEUTICAL AND FOOD COMPOSITION FOR PREVENTING OR
TREATING CAVITY AND PERIODONTAL DISEASE COMPRISING EXTRACT OF
YACON AS EFFECTIVE COMPONENT**

Inventor: JANG MI HYANG, et al  
PURPOSE: A composition containing yacon extract is provided to
ensure strong antibacterial activity against bacteria causing
dental caries or periodontitis. CONSTITUTION: An antibacterial
composition against bacteria against dental caries or
periodontitis contains yacon extract as an active ingredient. The
bacteria causing dental caries are Streptococcus mutans,
Streptococcus sobrinus, or Lactobacillus salivarius. A
pharmaceutical composition for preventing or treating dental
caries or periodontal diseases contains yacon extract as an active
ingredient.  
  


---